6. Variant calling¶
- To detect both small and large variants among paths from the pangenome graph, we utilized the Variation Graph (VG) toolkit to deconstruct these variants into VCF files.
- To decompose the graph into a VCF file, we need to choose one path as a reference for comparison with the others (any path can serve as this reference)
- In fact, during the pangenome graph construction process, when the parameter -V 'NC_017518.1:#' is activated, the output file includes the VCF based on the NC_017518.1 reference.
vg deconstruct graph to get the variations in vcf¶
Set up directory for VG and GFA files.
code
-
Return to working directory
-
Create VG directory
-
Copy the gfa file to the directory
Load the necessary modules for an example run.
An example run to obtain VCF files from GFA.
code
- check the paths in the graph using tail, which depends on the number of genomes. We have five input genomes for the 5NM dataset.
Output
P NC_003112.2#1#1 1+,2+,4+,5+,7+,8+,10+,12+,13+,14+,16+,18+,19+,21+,22+,23+,25+,26+,28+>
P NC_017518.1#1#1 1+,3+,4+,5+,7+,8+,10+,11+,13+,14+,16+,17+,19+,20+,22+,24+,25+,27+,28+>
P NZ_CP007668.1#1#1 1+,3+,4+,5+,7+,8+,10+,11+,13+,14+,16+,17+,19+,20+,22+,24+,25+,27+,28+>
P NZ_CP016880.1#1#1 1+,2+,4+,6+,7+,9+,10+,12+,13+,15+,16+,18+,19+,21+,22+,24+,25+,27+,28+>
P NZ_CP020423.2#1#1 1+,2+,4+,6+,7+,9+,10+,12+,13+,14+,16+,18+,19+,21+,22+,24+,25+,27+,28+>
code
vg deconstruct -h
#use vg deconstruct the graph into VCF based on the first path NC_003112.2
#-e, --path-traversals Only consider traversals that correspond to paths in the graph.
#-a, --all-snarls Process all snarls, including nested snarls (by default only top-level snarls reported).
#-H, --path-sep SEP Obtain alt paths from the set of paths, assuming a path name hierarchy (e.g. SEP='#' and sample#phase#contig)
-
vg deconstruct for the 5NM_2Kb94.gfa using the path NC_003112.2 as reference
-
use vg deconstruct the graph into VCF based on the second path NC_017518.1
-
use bcftools stats to check the statistics for the vcf file
check the vcf files¶
check the statistics of vcf files
Output
# This file was produced by bcftools stats (1.15.1+htslib-1.23.1) and can be plotted using plot-vcfstats.
# The command line was: bcftools stats 5NM_2Kb94aep1.vcf.gz
#
# Definition of sets:
# ID [2]id [3]tab-separated file names
ID 0 5NM_2Kb94aep1.vcf.gz
# SN, Summary numbers:
# number of records .. number of data rows in the VCF
# number of no-ALTs .. reference-only sites, ALT is either "." or identical to REF
# number of SNPs .. number of rows with a SNP
# number of MNPs .. number of rows with a MNP, such as CC>TT
# number of indels .. number of rows with an indel
# number of others .. number of rows with other type, for example a symbolic allele or
# a complex substitution, such as ACT>TCGA
# number of multiallelic sites .. number of rows with multiple alternate alleles
# number of multiallelic SNP sites .. number of rows with multiple alternate alleles, all SNPs
#
# Note that rows containing multiple types will be counted multiple times, in each
# counter. For example, a row with a SNP and an indel increments both the SNP and
# the indel counter.
#
# SN [2]id [3]key [4]value
SN 0 number of samples: 4
SN 0 number of records: 75703
SN 0 number of no-ALTs: 0
SN 0 number of SNPs: 66313
SN 0 number of MNPs: 6901
SN 0 number of indels: 3286
SN 0 number of others: 1009
SN 0 number of multiallelic sites: 3757
SN 0 number of multiallelic SNP sites: 1363
Inspect the vcf files
Output
##fileformat=VCFv4.2
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##INFO=<ID=CONFLICT,Number=.,Type=String,Description="Sample names for which there are multiple paths in the graph with conflicting alleles">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=LV,Number=1,Type=Integer,Description="Level in the snarl tree (0=top level)">
##INFO=<ID=PS,Number=1,Type=String,Description="ID of variant corresponding to parent snarl">
##INFO=<ID=AT,Number=R,Type=String,Description="Allele Traversal as path in graph">
##contig=<ID=NC_003112.2#1#1,length=2272360>
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NC_017518.1#1#1 NZ_CP007668.1#1#1 NZ_CP016880.1#1#1 NZ_CP020423.2#1#1
1 152 >1>4 C T 60 . AC=2;AF=0.5;AN=4;AT=>1>2>4,>1>3>4;NS=4;LV=0 GT 1 1 0 0
1 510 >4>7 A G 60 . AC=2;AF=0.5;AN=4;AT=>4>5>7,>4>6>7;NS=4;LV=0 GT 0 0 1 1
1 558 >7>10 A G 60 . AC=2;AF=0.5;AN=4;AT=>7>8>10,>7>9>10;NS=4;LV=0 GT 0 0 1 1
1 954 >10>13 G A 60 . AC=2;AF=0.5;AN=4;AT=>10>12>13,>10>11>13;NS=4;LV=0 GT 1 1 0 0
1 1139 >13>16 A G 60 . AC=1;AF=0.25;AN=4;AT=>13>14>16,>13>15>16;NS=4;LV=0 GT 0 0 1 0
1 1411 >16>19 G A 60 . AC=2;AF=0.5;AN=4;AT=>16>18>19,>16>17>19;NS=4;LV=0 GT 1 1 0 0
1 1539 >19>22 T C 60 . AC=2;AF=0.5;AN=4;AT=>19>21>22,>19>20>22;NS=4;LV=0 GT 1 1 0 0
1 1561 >22>25 A G 60 . AC=4;AF=1;AN=4;AT=>22>23>25,>22>24>25;NS=4;LV=0 GT 1 1 1 1
1 1630 >25>28 G C 60 . AC=4;AF=1;AN=4;AT=>25>26>28,>25>27>28;NS=4;LV=0 GT 1 1 1 1
1 1674 >28>31 T C 60 . AC=4;AF=1;AN=4;AT=>28>29>31,>28>30>31;NS=4;LV=0 GT 1 1 1 1
1 1781 >31>34 A G 60 . AC=4;AF=1;AN=4;AT=>31>32>34,>31>33>34;NS=4;LV=0 GT 1 1 1 1
1 1809 >34>36 AT A 60 . AC=4;AF=1;AN=4;AT=>34>35>36,>34>36;NS=4;LV=0 GT 1 1 1 1
1 1819 >36>38 AT A 60 . AC=4;AF=1;AN=4;AT=>36>37>38,>36>38;NS=4;LV=0 GT 1 1 1 1
1 1894 >38>41 G C 60 . AC=4;AF=1;AN=4;AT=>38>39>41,>38>40>41;NS=4;LV=0 GT 1 1 1 1
1 1909 >41>44 A G 60 . AC=4;AF=1;AN=4;AT=>41>42>44,>41>43>44;NS=4;LV=0 GT 1 1 1 1
1 1974 >44>47 A G 60 . AC=4;AF=1;AN=4;AT=>44>45>47,>44>46>47;NS=4;LV=0 GT 1 1 1 1
1 2069 >47>50 A G 60 . AC=4;AF=1;AN=4;AT=>47>48>50,>47>49>50;NS=4;LV=0 GT 1 1 1 1
1 2073 >50>53 T C 60 . AC=2;AF=0.5;AN=4;AT=>50>51>53,>50>52>53;NS=4;LV=0 GT 0 0 1 1
1 2079 >53>56 T C 60 . AC=4;AF=1;AN=4;AT=>53>54>56,>53>55>56;NS=4;LV=0 GT 1 1 1 1
1 2084 >56>59 AT GG 60 . AC=4;AF=1;AN=4;AT=>56>57>59,>56>58>59;NS=4;LV=0 GT 1 1 1 1
1 2089 >59>62 T C 60 . AC=4;AF=1;AN=4;AT=>59>60>62,>59>61>62;NS=4;LV=0 GT 1 1 1 1
1 2099 >62>64 A AC 60 . AC=4;AF=1;AN=4;AT=>62>64,>62>63>64;NS=4;LV=0 GT 1 1 1 1
1 2178 >64>67 G A 60 . AC=4;AF=1;AN=4;AT=>64>65>67,>64>66>67;NS=4;LV=0 GT 1 1 1 1
1 2200 >67>70 A G 60 . AC=4;AF=1;AN=4;AT=>67>68>70,>67>69>70;NS=4;LV=0 GT 1 1 1 1
1 2290 >70>73 C T 60 . AC=4;AF=1;AN=4;AT=>70>71>73,>70>72>73;NS=4;LV=0 GT 1 1 1 1
1 2359 >73>76 T C 60 . AC=4;AF=1;AN=4;AT=>73>74>76,>73>75>76;NS=4;LV=0 GT 1 1 1 1
1 2362 >76>79 C T 60 . AC=4;AF=1;AN=4;AT=>76>77>79,>76>78>79;NS=4;LV=0 GT 1 1 1 1
1 2392 >79>84 CG AG,AA 60 . AC=2,2;AF=0.5,0.5;AN=4;AT=>79>80>82>84,>79>81>82>84,>79>81>83>84;NS=4;LV=0 GT 2 2 1 1
1 2491 >84>87 G A 60 . AC=2;AF=0.5;AN=4;AT=>84>85>87,>84>86>87;NS=4;LV=0 GT 0 0 1 1
1 2494 >87>90 T C 60 . AC=2;AF=0.5;AN=4;AT=>87>88>90,>87>89>90;NS=4;LV=0 GT 0 0 1 1
1 2503 >90>93 A C 60 . AC=4;AF=1;AN=4;AT=>90>91>93,>90>92>93;NS=4;LV=0 GT 1 1 1 1
check the complex variation in vcf files
Output
```
##INFO=<ID=CONFLICT,Number=.,Type=String,Description="Sample names for which there are multiple paths in the graph with conflicting alleles">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=LV,Number=1,Type=Integer,Description="Level in the snarl tree (0=top level)">
##INFO=<ID=PS,Number=1,Type=String,Description="ID of variant corresponding to parent snarl">
##INFO=<ID=AT,Number=R,Type=String,Description="Allele Traversal as path in graph">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NC_017518.1#1#1 NZ_CP007668.1#1#1 NZ_CP016880.1#1#1 NZ_CP020423.2#1#1
1 3441 >250>600 CCAACCTCGCCAAAGTCCGCAAACAAGTAACTGCTTTGTGCAATAAATACCCCGTTTACGGCGCGTAAGCCTTTTTAAAAATATTCCGCCAAGCAATCCAATGCCGCCTGAAATCTCATAATGTTTCAGGCGGAAACCTTTGCAAAAATCCCCAAAATCCCCTAAATT>
1 4164 >392>397 GCG AAG,AAA 60 . AC=1,1;AF=0.5,0.5;AN=2;AT=>392>393>395>397,>392>394>395>397,>392>394>396>397;NS=2;LV=1;PS=>250>600 GT 2 1 . .
1 4178 >397>402 ATCAAGAAAAACGGC AT,ACAAAGAAAAACGGC 60 . AC=1,1;AF=0.5,0.5;AN=2;AT=>397>398>399>401>402,>397>398>402,>397>400>401>402;NS=2;LV=1;PS=>250>600 GT >
1 4394 >426>431 TTG TTA,CAG 60 . AC=1,1;AF=0.5,0.5;AN=2;AT=>426>427>429>431,>426>427>430>431,>426>428>429>431;NS=2;LV=1;PS=>250>600 GT 2 1 . .
1 4918 >518>520 TCC T 60 . AC=1;AF=0.5;AN=2;AT=>518>519>520,>518>520;NS=2;LV=1;PS=>250>600 GT 1 0 . .
1 5116 >529>553 TCCCGTCATTCCCGCGCAGGCGGGAATCTAGGTTTGTCGGCACGGAAACTTATCGGGTAAAACGGTTTCTTTAGATTTTACGTTCTAGATTCCCGCCTGCGCGGGAATGACGATGAAAAGATTGTTGTCGCTTCGGATAAATTTTTGTCGCGTTGGGTTCTAGATTCC>
1 5441 >553>556 TCCCC T,TCCC 60 . AC=1,1;AF=0.5,0.5;AN=2;AT=>553>554>555>556,>553>556,>553>555>556;NS=2;LV=1;PS=>250>600 GT 2 1 . .
1 6462 >600>603 ACT AA 60 . AC=3;AF=0.75;AN=4;AT=>600>601>603,>600>602>603;NS=4;LV=0 GT 1 0 1 1
1 8056 >938>1174 AGCTGCGCCGCCAGCGTGCAGAACGCCGCAACGTACAGGGACAAGTCAACTTCAAGCTCGATAGCGGTGAGAAAAGTGGCAAAATCATCGCCGAATTGGAACACGCTTCGTTTGCCTATGGCGGCAAAGTCATTATGGACAAATTCTCCGCTATCTTGCAGCGCGGCG>
1 40957 >1264>1267 CACCCAGTTGCGCCAAAGCTGCGCCATCCCGCTC TACACAGTTACGCCAAAGTTGCGCCATCCCGCTT 60 . AC=2;AF=0.5;AN=4;AT=>1264>1266>1267,>1264>1265>1267;NS=4;LV=0 GT >
1 42763 >1445>1450 TGG CAA,CAG 60 . AC=2,1;AF=0.5,0.25;AN=4;AT=>1445>1448>1449>1450,>1445>1446>1447>1450,>1445>1446>1449>1450;NS=4;LV=0 GT 2 0 1 1
1 42797 >1465>1470 CGCG CATA,TGCG 60 . AC=2,1;AF=0.5,0.25;AN=4;AT=>1465>1466>1469>1470,>1465>1466>1467>1470,>1465>1468>1469>1470;NS=4;LV=0 GT 0 2 >
1 43307 >1650>1653 GAG TTC 60 . AC=1;AF=0.25;AN=4;AT=>1650>1652>1653,>1650>1651>1653;NS=4;LV=0 GT 0 1 0 0
1 45378 >1733>1738 GGCCCGCTTCAGGGGC GGCGCGCTTCAGGGGC,G 60 . AC=2,2;AF=0.5,0.5;AN=4;AT=>1733>1734>1736>1737>1738,>1733>1734>1735>1737>1738,>1733>1738;NS=4;LV=0 >
1 47380 >1813>1815 TCG T 60 . AC=4;AF=1;AN=4;AT=>1813>1814>1815,>1813>1815;NS=4;LV=0 GT 1 1 1 1
1 47406 >1837>1839 AACGGAAT A 60 . AC=4;AF=1;AN=4;AT=>1837>1838>1839,>1837>1839;NS=4;LV=0 GT 1 1 1 1
1 47431 >1851>1854 AAA CTT 60 . AC=4;AF=1;AN=4;AT=>1851>1853>1854,>1851>1852>1854;NS=4;LV=0 GT 1 1 1 1
1 47447 >1861>1863 ACG A 60 . AC=4;AF=1;AN=4;AT=>1861>1862>1863,>1861>1863;NS=4;LV=0 GT 1 1 1 1
1 47451 >1863>1866 TCCG TT 60 . AC=4;AF=1;AN=4;AT=>1863>1865>1866,>1863>1864>1866;NS=4;LV=0 GT 1 1 1 1
1 47457 >1866>1869 GAA TCC 60 . AC=4;AF=1;AN=4;AT=>1866>1868>1869,>1866>1867>1869;NS=4;LV=0 GT 1 1 1 1
1 47464 >1872>1874 TCCATTGCCGCATTGTCCAAGCAGTTTCCCTTGCGGGACATACTCTGAACCAGACCGTTGCCTTTCAACTGCTTTTG T 60 . AC=4;AF=1;AN=4;AT=>1872>1873>1874,>1872>1874;NS=4;LV=0 GT >
1 48557 >1944>1949 TCG CGG,CGA 60 . AC=2,1;AF=0.5,0.25;AN=4;AT=>1944>1946>1948>1949,>1944>1945>1948>1949,>1944>1945>1947>1949;NS=4;LV=0 GT 0 2 1 1
1 48645 >1982>1985 CAC AGA 60 . AC=1;AF=0.25;AN=4;AT=>1982>1984>1985,>1982>1983>1985;NS=4;LV=0 GT 0 0 0 1
1 48936 >2036>2040 TAT TGT,TG 60 . AC=2,1;AF=0.5,0.25;AN=4;AT=>2036>2038>2039>2040,>2036>2037>2039>2040,>2036>2037>2040;NS=4;LV=0 GT 0 1 2 1
1 48942 >2040>2042 CCT C 60 . AC=1;AF=0.25;AN=4;AT=>2040>2041>2042,>2040>2042;NS=4;LV=0 GT 0 0 1 0
1 49330 >2124>2129 TGT TGG,ATT 60 . AC=3,1;AF=0.75,0.25;AN=4;AT=>2124>2126>2128>2129,>2124>2126>2127>2129,>2124>2125>2128>2129;NS=4;LV=0 GT 1 2 1 1
1 49436 >2170>2275 ACTTGTCTGACATGGAAAAATCCCTGTATTGAATTAAAAATCAATACAGGGATTGTAGGAAAGGCCGTCTGACTAAGCCTTTAATACGGGTTAAAACTTAATCAGTAGAGAGAGATGTGAGGATGATTTTTTTAGGCTTACGAGAGCCATTTTGCTTTAAGTCAAACT>
1 50804 >2210>2213 AGAT A 60 . AC=1;AF=1;AN=1;AT=>2210>2211>2212>2213,>2210>2213;NS=1;LV=1;PS=>2170>2275 GT 1 . . .
1 50904 >2230>2233 ATTC GGCA 60 . AC=1;AF=1;AN=1;AT=>2230>2232>2233,>2230>2231>2233;NS=1;LV=1;PS=>2170>2275 GT 1 . . .
1 53387 >2355>2358 CAA ATG 60 . AC=1;AF=0.25;AN=4;AT=>2355>2357>2358,>2355>2356>2358;NS=4;LV=0 GT 1 0 0 0
1 53393 >2361>2364 ACAA TTTC 60 . AC=1;AF=0.25;AN=4;AT=>2361>2362>2364,>2361>2363>2364;NS=4;LV=0 GT 1 0 0 0
1 53414 >2381>2383 CGAT C 60 . AC=1;AF=0.25;AN=4;AT=>2381>2382>2383,>2381>2383;NS=4;LV=0 GT 1 0 0 0
1 53471 >2404>2407 AGCG CCAC 60 . AC=1;AF=0.25;AN=4;AT=>2404>2406>2407,>2404>2405>2407;NS=4;LV=0 GT 1 0 0 0
1 53493 >2416>2419 TCAA CTTG 60 . AC=1;AF=0.25;AN=4;AT=>2416>2418>2419,>2416>2417>2419;NS=4;LV=0 GT 1 0 0 0
1 53604 >2467>2469 TGGGCTG T 60 . AC=1;AF=0.25;AN=4;AT=>2467>2468>2469,>2467>2469;NS=4;LV=0 GT 1 0 0 0
```
Extract distance among paths¶
code
code