Skip to content

5. Evaluating output

  • When we ran PGGB, the 'odgi stats -S' option was utilized to generate statistics for both the seqwish and smoothxg graphs and the 'multiqc -m' option was employed to generate a MultiQC report, providing comprehensive statistics and visualizations of the graphs. All pertinent results can be located in the MultiQC report, which is saved in HTML format.
  • The output folder contains all the PGGB-related results, including the .smooth.final.og and all associated visualization figures. It also includes .final.smooth.gfa (a Graphical Fragment Assembly file), as well as variations of the graph presented in a VCF (Variant Call Format) file

check the files

code

cd  ~/pg_workshop/5NM_2Kb94
ls  

Output
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.07-24-2023_10:49:02.log         
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.07-24-2023_10:49:02.params.yml  
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.gfa                       
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.NC_017518.1.vcf           
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.NC_017518.1.vcf.stats     
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og                        
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.lay                    
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.lay.draw_multiqc.png   
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.lay.draw.png           
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.lay.tsv                
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.stats.yaml             
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_depth_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_inv_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_O_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_pos_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_uncalled_multiqc.png
5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.fix.affixes.tsv.gz
5NM.fa.fefc7f5.417fcdf.seqwish.og.stats.yaml
5NM.fa.fefc7f5.alignments.wfmash.paf
multiqc_config.yaml
multiqc_data
multiqc_report.html

check the .gfa file.

  • (Graphical Fragment Assembly) GFA is a file format commonly used to represent assembly graphs or sequence variation graphs

code

head 5NM*.gfa | less -S 
Output
H       VN:Z:1.0
S       1       GTGGCTAAAACATATTTATTGACTGCATTGATAATGTCTATGACAATCTCTGGATGTCAAGTCATCCATGCCAATCA>
L       1       +       2       +       0M
L       1       +       3       +       0M
S       2       C
L       2       +       4       +       0M
S       3       T
L       3       +       4       +       0M
S       4       CGAACAAAAGCAGGTGATTGCAAGTGATTTTATGGTAGCGTCAGCCAATCCATTAGCAACACAAGCTGGCTATGATA>
L       4       +       6       +       0M
tail 5NM*.gfa | less -S 
output

bash S 245456 A L 245456 + 245458 + 0M S 245457 G L 245457 + 245458 + 0M S 245458 TCGGCCAACCTTTCCACAGCTTTGGGTTAATGGTGAGTTAATCGGTGGTAGTGATATTATCCTACAAATGTACCAATCAGGTGAG> P NC_003112.2#1#1 1+,2+,4+,5+,7+,8+,10+,12+,13+,14+,16+,18+,19+,21+,22+,23+,25+,26+,28+,29+,31+> P NC_017518.1#1#1 1+,3+,4+,5+,7+,8+,10+,11+,13+,14+,16+,17+,19+,20+,22+,24+,25+,27+,28+,30+,31+> P NZ_CP007668.1#1#1 1+,3+,4+,5+,7+,8+,10+,11+,13+,14+,16+,17+,19+,20+,22+,24+,25+,27+,28+,30+,31+> P NZ_CP016880.1#1#1 1+,2+,4+,6+,7+,9+,10+,12+,13+,15+,16+,18+,19+,21+,22+,24+,25+,27+,28+,30+,31+> P NZ_CP020423.2#1#1 1+,2+,4+,6+,7+,9+,10+,12+,13+,14+,16+,18+,19+,21+,22+,24+,25+,27+,28+,30+,31+>

what does S, L, P mean

S means DNA segments, L means links between notes, and P means paths

Pangenome graph visualization using ODGI

ODGI Compressed 1D visualization

ODGI Compressed 1D visualization

This image shows a 1D rendering of the built pangenome graph. The graph nodes are arranged from left to right, forming the pangenome sequence. Summarization of path coverage across all paths. Dark blue means highest coverage. Dark red means lowest coverage. The path names are placed on the left. The black lines under the paths are the links, which represent the graph topology.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_O_multiqc_1.png -x 1500 -y 500 -a 10 -O -I Consensus_  

ODGI 1D visualization

ODGI 1D visualization

This image shows a 1D rendering of the built pangenome graph. The graph nodes are arranged from left to right, forming the pangenome sequence. The colored bars represent the paths versus the pangenome sequence in a binary matrix. The path names are placed on the left. The black lines under the paths are the links, which represent the graph topology.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_multiqc_1.png -x 1500 -y 500 -a 10 -I Consensus_  

ODGI 1D visualization by path position

ODGI 1D visualization by path position

This shows a 1D rendering of the built pangenome graph where the paths are colored according to their nucleotide position. Light grey means a low path position, black is the highest path position.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_pos_multiqc_1.png -x 1500 -y 500 -a 10 -u -d -I Consensus_ 

ODGI 1D visualization by path orientation

ODGI 1D visualization by path orientation This image shows a 1D rendering of the built pangenome graph where the paths are colored by orientation. Forward is black, reverse is red.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_inv_multiqc_1.png -x 1500 -y 500 -a 10 -z -I Consensus_

1D visualization by node depth

ODGI 1D visualization by node depth This shows a 1D rendering of the built pangenome graph where the paths are colored according to path depth. Using the Spectra color palette with 4 levels of path depths, white indicates no depth, while grey, red, and yellow indicate depth 1, 2, and greater than or equal to 3, respectively.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_depth_multiqc_1.png -x 1500 -y 500 -a 10 -m -I Consensus_ 

ODGI 1D visualization by uncalled bases

ODGI 1D visualization by uncalled bases This shows a 1D rendering of the built pangenome graph where the paths are colored according to the coverage of uncalled bases. The lighter the green, the higher the 'N' content of a node is.

ODGI Compressed 1D visualization

odgi viz -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.viz_uncalled_multiqc_1.png -x 1500 -y 500 -a 10 -N -I Consensus_ 

ODGI 2D drawing

![ODGI 2D visualization](theme_figures/5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og.lay.draw.png)

how to generate graph 2D visualization using odgi

  • Compute the layout first

    odgi layout -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -o ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -P -t 16
    

  • Retrieve the image

    odgi draw -i ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -c ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og -p ./5NM.fa.fefc7f5.417fcdf.e2ae00b.smooth.final.og
    

Generate graph 2D visualization using gfaestus

https://github.com/chfi/gfaestus once you have it installed, you can use the following command to generate 2D visulization for a graph

gfaestus ${x}.gfa ${x}.gfa.tsv

2D visulizatio by gfaestus

Check the statistics statistics for both the seqwish and smoothxg graphs

5NM -s 2000, -p 94, -k default

Sample Name Length Nodes Edges Paths Components A C T G N
seqwish 3213544 122575 164967 5 1 796617 815725 800622 800480 100
smooth 2964772 246887 332917 5 1 745161 757008 737404 725099 100