R Basics continued - data frames and manipulation¶
Learning outcomes
- It is easy to import data into R from tabular formats including Excel. However, you still need to check that R has imported and interpreted your data correctly
- There are best practices for organising your data (keeping it tidy) and R is great for this
- Base R has many useful functions for manipulating your data, but all of R's capabilities are greatly enhanced by software packages developed by the community
- Understand the basic principle of tidy datasets
- Be able to load a tabular dataset using base R functions
- Be able to determine the structure of a data frame including its dimensions and the datatypes of variables
- Be able to subset/retrieve values from a data frame
- Be able to change the mode of an object
- Be able to apply an arithmetic function to a data frame
- Be able to import data from Excel
- Be able to save a data frame as a delimited file
- How do I get started with tabular data (e.g., spreadsheets) in R?
- What are some best practices for reading data into R?
- How do I save tabular data generated in R?
Working with spreadsheets (tabular data)¶
A substantial amount of the data we work with in genomics will be tabular data, this is data arranged in rows and columns - also known as spreadsheets. We could write a whole lesson on how to work with spreadsheets effectively (actually the Carpentries did). For our purposes, we want to remind you of a few principles before we work with our first set of example data:
1) Keep raw data separate from analysed data
This is principle number one because if you can't tell which files are the original raw data, you risk making some serious mistakes (e.g., drawing conclusion from data which have been manipulated in some unknown way).
2) Keep spreadsheet data Tidy
The simplest principle of Tidy data is that we have one row in our spreadsheet for each observation or sample, and one column for every variable that we measure or report on. As simple as this sounds, it's very easily violated. Most data scientists agree that significant amounts of their time is spent tidying data for analysis. Read more about data sation in this Carpentries lesson and in this paper.
3) Trust but verify
Finally, while you don't need to be paranoid about data, you should have a plan for how you will prepare it for analysis. This a focus of this lesson. You probably already have a lot of intuition, expectations, assumptions about your data - the range of values you expect, how many values should have been recorded, etc. Of course, as the data get larger our human ability to keep track will start to fail (and yes, it can fail for small data sets too). R will help you to examine your data so that you can have greater confidence in your analysis and its reproducibility.
Keeping your raw data separate
When you work with data in R, you are not changing the original file
you loaded that data from. This is different from (for example)
working with a spreadsheet program where changing the value of the
cell leaves you one "save"-click away from overwriting the original
file. You have to purposely use a writing function
(e.g., write.csv()) to save data loaded into R. In that case, be sure
to save the manipulated data into a new file. More on this later in
the lesson.
Importing tabular data into R¶
There are several ways to import data into R. For our purpose here, we
will focus on using the tools every R installation comes with (so called
"base" R) to import a comma-delimited file containing the results of our
variant calling workflow. We will need to load the sheet using a
function called read.csv().
Now, let's read in the file combined_tidy_vcf.csv which will be
located in /home/shared/<user>/R4Genomics/. Call/assign this data variants.
The first argument to pass to our read.csv() function is the file path for our
data. The file path must be in quotes and now is a good time to remember
to use tab autocompletion. If you use tab autocompletion you avoid
typos and errors in file paths. Use it!
r
One of the first things you should notice is that in the Environment
window, you have the variants object, listed as 801 obs.
(observations/rows) of 29 variables (columns). Double-clicking on the
name of the object will open a view of the data in a new tab.
Summarising and determining the structure of a data frame.¶
A data frame is the standard way to store tabular data in R. A data frame could also be thought of as a collection of vectors, all of which have the same length. Using only two functions, we can learn a lot about out data frame including some summary statistics as well as the "structure" of the data frame. Let's examine what each of these functions can tell us:
r
Output
'data.frame': 801 obs. of 29 variables:
$ sample_id : chr "SRR2584863" "SRR2584863" "SRR2584863" "SRR2584863" ...
$ CHROM : chr "CP000819.1" "CP000819.1" "CP000819.1" "CP000819.1" ...
$ POS : int 9972 263235 281923 433359 473901 648692 1331794 1733343 2103887 2333538 ...
$ ID : logi NA NA NA NA NA NA ...
$ REF : chr "T" "G" "G" "CTTTTTTT" ...
$ ALT : chr "G" "T" "T" "CTTTTTTTT" ...
$ QUAL : num 91 85 217 64 228 210 178 225 56 167 ...
$ FILTER : logi NA NA NA NA NA NA ...
$ INDEL : logi FALSE FALSE FALSE TRUE TRUE FALSE ...
$ IDV : int NA NA NA 12 9 NA NA NA 2 7 ...
$ IMF : num NA NA NA 1 0.9 ...
$ DP : int 4 6 10 12 10 10 8 11 3 7 ...
$ VDB : num 0.0257 0.0961 0.7741 0.4777 0.6595 ...
$ RPB : num NA 1 NA NA NA NA NA NA NA NA ...
$ MQB : num NA 1 NA NA NA NA NA NA NA NA ...
$ BQB : num NA 1 NA NA NA NA NA NA NA NA ...
$ MQSB : num NA NA 0.975 1 0.916 ...
$ SGB : num -0.556 -0.591 -0.662 -0.676 -0.662 ...
$ MQ0F : num 0 0.167 0 0 0 ...
$ ICB : logi NA NA NA NA NA NA ...
$ HOB : logi NA NA NA NA NA NA ...
$ AC : int 1 1 1 1 1 1 1 1 1 1 ...
$ AN : int 1 1 1 1 1 1 1 1 1 1 ...
$ DP4 : chr "0,0,0,4" "0,1,0,5" "0,0,4,5" "0,1,3,8" ...
$ MQ : int 60 33 60 60 60 60 60 60 60 60 ...
$ Indiv : chr "/home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam" "/home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam" "/home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam" "/home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam" ...
$ gt_PL : chr "121,0" "112,0" "247,0" "91,0" ...
$ gt_GT : int 1 1 1 1 1 1 1 1 1 1 ...
$ gt_GT_alleles: chr "G" "T" "T" "CTTTTTTTT" ...
Ok, that is a lot up unpack! Some things to notice.
- The object type
data.frameis displayed in the first row along with its dimensions, in this case 801 observations (rows) and 29 variables (columns). - Each variable (column) has a name (e.g.,
sample_id). This is followed by the object mode (e.g., chr, int, etc.). Notice that before each variable name there is a$(this will be important later).
Now let's look at some summary statistics for our dataframe:
r
Output
sample_id CHROM POS ID REF
Length:801 Length:801 Min. : 1521 Mode:logical Length:801
Class :character Class :character 1st Qu.:1115970 NA's:801 Class :character
Mode :character Mode :character Median :2290361 Mode :character
Mean :2243682
3rd Qu.:3317082
Max. :4629225
ALT QUAL FILTER INDEL IDV IMF
Length:801 Min. : 4.385 Mode:logical Mode :logical Min. : 2.000 Min. :0.5714
Class :character 1st Qu.:139.000 NA's:801 FALSE:700 1st Qu.: 7.000 1st Qu.:0.8824
Mode :character Median :195.000 TRUE :101 Median : 9.000 Median :1.0000
Mean :172.276 Mean : 9.396 Mean :0.9219
3rd Qu.:225.000 3rd Qu.:11.000 3rd Qu.:1.0000
Max. :228.000 Max. :20.000 Max. :1.0000
NA's :700 NA's :700
DP VDB RPB MQB BQB
Min. : 2.00 Min. :0.0005387 Min. :0.0000 Min. :0.0000 Min. :0.1153
1st Qu.: 7.00 1st Qu.:0.2180410 1st Qu.:0.3776 1st Qu.:0.1070 1st Qu.:0.6963
Median :10.00 Median :0.4827410 Median :0.8663 Median :0.2872 Median :0.8615
Mean :10.57 Mean :0.4926291 Mean :0.6970 Mean :0.5330 Mean :0.7784
3rd Qu.:13.00 3rd Qu.:0.7598940 3rd Qu.:1.0000 3rd Qu.:1.0000 3rd Qu.:1.0000
Max. :79.00 Max. :0.9997130 Max. :1.0000 Max. :1.0000 Max. :1.0000
NA's :773 NA's :773 NA's :773
MQSB SGB MQ0F ICB HOB AC
Min. :0.01348 Min. :-0.6931 Min. :0.00000 Mode:logical Mode:logical Min. :1
1st Qu.:0.95494 1st Qu.:-0.6762 1st Qu.:0.00000 NA's:801 NA's:801 1st Qu.:1
Median :1.00000 Median :-0.6620 Median :0.00000 Median :1
Mean :0.96428 Mean :-0.6444 Mean :0.01127 Mean :1
3rd Qu.:1.00000 3rd Qu.:-0.6364 3rd Qu.:0.00000 3rd Qu.:1
Max. :1.01283 Max. :-0.4536 Max. :0.66667 Max. :1
NA's :48
AN DP4 MQ Indiv gt_PL gt_GT
Min. :1 Length:801 Min. :10.00 Length:801 Length:801 Min. :1
1st Qu.:1 Class :character 1st Qu.:60.00 Class :character Class :character 1st Qu.:1
Median :1 Mode :character Median :60.00 Mode :character Mode :character Median :1
Mean :1 Mean :58.19 Mean :1
3rd Qu.:1 3rd Qu.:60.00 3rd Qu.:1
Max. :1 Max. :60.00 Max. :1
gt_GT_alleles
Length:801
Class :character
Mode :character
Our data frame has 29 variables, so we get 29 fields that summarise the data.
The QUAL, IMF, and VDB variables (and several others) are
numerical data and so you get summary statistics on the minimum and maximum
values for these columns, as well as mean, median, and 1st and 3rd quantile.
Many of the other variables (e.g., sample_id) are treated as character data
(more on this in a bit).
Subsetting data frames¶
Next, we are going to talk about how you can get specific values from data frames.
The first thing to remember is that a data frame is two-dimensional
(rows and columns). Therefore, to select a specific value we will will
once again use [] (bracket) notation, but we will specify more than
one value (except in some cases where we are taking a range).
Exercise: Subsetting a data frame
Try the following indices and functions and try to figure out what they return
a. variants[1, 1]
b. variants[2, 4]
c. variants[801, 29]
d. variants[2,]
e. variants[-1,]
f. variants[1:4, 1]
g. variants[1:10, c("REF","ALT")]
h. variants[, c("sample_id")]
i. head(variants)
j. tail(variants)
k. variants$sample_id
l. variants[variants$REF == "A",]
Output
a.
b.
c.
d.
sample_id CHROM POS ID REF ALT QUAL FILTER INDEL IDV IMF DP VDB RPB MQB BQB
2 SRR2584863 CP000819.1 263235 NA G T 85 NA FALSE NA NA 6 0.096133 1 1 1
MQSB SGB MQ0F ICB HOB AC AN DP4 MQ
2 NA -0.590765 0.166667 NA NA 1 1 0,1,0,5 33
Indiv gt_PL gt_GT gt_GT_alleles
2 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 112,0 1 T
e.
sample_id CHROM POS ID REF ALT QUAL FILTER INDEL IDV IMF
2 SRR2584863 CP000819.1 263235 NA G T 85 NA FALSE NA NA
3 SRR2584863 CP000819.1 281923 NA G T 217 NA FALSE NA NA
4 SRR2584863 CP000819.1 433359 NA CTTTTTTT CTTTTTTTT 64 NA TRUE 12 1.0
5 SRR2584863 CP000819.1 473901 NA CCGC CCGCGC 228 NA TRUE 9 0.9
6 SRR2584863 CP000819.1 648692 NA C T 210 NA FALSE NA NA
7 SRR2584863 CP000819.1 1331794 NA C A 178 NA FALSE NA NA
DP VDB RPB MQB BQB MQSB SGB MQ0F ICB HOB AC AN DP4 MQ
2 6 0.096133 1 1 1 NA -0.590765 0.166667 NA NA 1 1 0,1,0,5 33
3 10 0.774083 NA NA NA 0.974597 -0.662043 0.000000 NA NA 1 1 0,0,4,5 60
4 12 0.477704 NA NA NA 1.000000 -0.676189 0.000000 NA NA 1 1 0,1,3,8 60
5 10 0.659505 NA NA NA 0.916482 -0.662043 0.000000 NA NA 1 1 1,0,2,7 60
6 10 0.268014 NA NA NA 0.916482 -0.670168 0.000000 NA NA 1 1 0,0,7,3 60
7 8 0.624078 NA NA NA 0.900802 -0.651104 0.000000 NA NA 1 1 0,0,3,5 60
Indiv gt_PL
2 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 112,0
3 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 247,0
4 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 91,0
5 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 255,0
6 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 240,0
7 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 208,0
gt_GT gt_GT_alleles
2 1 T
3 1 T
4 1 CTTTTTTTT
5 1 CCGCGC
6 1 T
7 1 A
f.
g.
REF
1 T
2 G
3 G
4 CTTTTTTT
5 CCGC
6 C
7 C
8 G
9 ACAGCCAGCCAGCCAGCCAGCCAGCCAGCCAG
10 AT
ALT
1 G
2 T
3 T
4 CTTTTTTTT
5 CCGCGC
6 T
7 A
8 A
9 ACAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAGCCAG
10 ATT
h.
i.
sample_id CHROM POS ID REF ALT QUAL FILTER INDEL IDV IMF DP VDB RPB
1 SRR2584863 CP000819.1 9972 NA T G 91 NA FALSE NA NA 4 0.0257451 NA
2 SRR2584863 CP000819.1 263235 NA G T 85 NA FALSE NA NA 6 0.0961330 1
3 SRR2584863 CP000819.1 281923 NA G T 217 NA FALSE NA NA 10 0.7740830 NA
4 SRR2584863 CP000819.1 433359 NA CTTTTTTT CTTTTTTTT 64 NA TRUE 12 1.0 12 0.4777040 NA
5 SRR2584863 CP000819.1 473901 NA CCGC CCGCGC 228 NA TRUE 9 0.9 10 0.6595050 NA
6 SRR2584863 CP000819.1 648692 NA C T 210 NA FALSE NA NA 10 0.2680140 NA
MQB BQB MQSB SGB MQ0F ICB HOB AC AN DP4 MQ
1 NA NA NA -0.556411 0.000000 NA NA 1 1 0,0,0,4 60
2 1 1 NA -0.590765 0.166667 NA NA 1 1 0,1,0,5 33
3 NA NA 0.974597 -0.662043 0.000000 NA NA 1 1 0,0,4,5 60
4 NA NA 1.000000 -0.676189 0.000000 NA NA 1 1 0,1,3,8 60
5 NA NA 0.916482 -0.662043 0.000000 NA NA 1 1 1,0,2,7 60
6 NA NA 0.916482 -0.670168 0.000000 NA NA 1 1 0,0,7,3 60
Indiv gt_PL gt_GT gt_GT_alleles
1 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 121,0 1 G
2 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 112,0 1 T
3 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 247,0 1 T
4 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 91,0 1 CTTTTTTTT
5 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 255,0 1 CCGCGC
6 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 240,0 1 T
j.
sample_id CHROM POS ID REF ALT QUAL FILTER INDEL IDV IMF DP
796 SRR2589044 CP000819.1 3444175 NA G T 184 NA FALSE NA NA 9
797 SRR2589044 CP000819.1 3481820 NA A G 225 NA FALSE NA NA 12
798 SRR2589044 CP000819.1 3893550 NA AG AGG 101 NA TRUE 4 1 4
799 SRR2589044 CP000819.1 3901455 NA A AC 70 NA TRUE 3 1 3
800 SRR2589044 CP000819.1 4100183 NA A G 177 NA FALSE NA NA 8
801 SRR2589044 CP000819.1 4431393 NA TGG T 225 NA TRUE 10 1 10
VDB RPB MQB BQB MQSB SGB MQ0F ICB HOB AC AN DP4 MQ
796 0.4714620 NA NA NA 0.992367 -0.651104 0 NA NA 1 1 0,0,4,4 60
797 0.8707240 NA NA NA 1.000000 -0.680642 0 NA NA 1 1 0,0,4,8 60
798 0.9182970 NA NA NA 1.000000 -0.556411 0 NA NA 1 1 0,0,3,1 52
799 0.0221621 NA NA NA NA -0.511536 0 NA NA 1 1 0,0,3,0 60
800 0.9272700 NA NA NA 0.900802 -0.651104 0 NA NA 1 1 0,0,3,5 60
801 0.7488140 NA NA NA 1.007750 -0.670168 0 NA NA 1 1 0,0,4,6 60
Indiv gt_PL
796 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 214,0
797 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 255,0
798 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 131,0
799 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 100,0
800 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 207,0
801 /home/dcuser/dc_workshop/results/bam/SRR2589044.aligned.sorted.bam 255,0
gt_GT gt_GT_alleles
796 1 T
797 1 G
798 1 AGG
799 1 AC
800 1 G
801 1 T
k.
l.
sample_id CHROM POS ID REF ALT QUAL FILTER INDEL IDV IMF DP
11 SRR2584863 CP000819.1 2407766 NA A C 104 NA FALSE NA NA 9
12 SRR2584863 CP000819.1 2446984 NA A C 225 NA FALSE NA NA 20
14 SRR2584863 CP000819.1 2665639 NA A T 225 NA FALSE NA NA 19
16 SRR2584863 CP000819.1 3339313 NA A C 211 NA FALSE NA NA 10
18 SRR2584863 CP000819.1 3481820 NA A G 200 NA FALSE NA NA 9
19 SRR2584863 CP000819.1 3488669 NA A C 225 NA FALSE NA NA 13
VDB RPB MQB BQB MQSB SGB MQ0F ICB HOB AC
11 0.0230738 0.900802 0.150134 0.750668 0.500000 -0.590765 0.333333 NA NA 1
12 0.0714027 NA NA NA 1.000000 -0.689466 0.000000 NA NA 1
14 0.9960390 NA NA NA 1.000000 -0.690438 0.000000 NA NA 1
16 0.4059360 NA NA NA 1.007750 -0.670168 0.000000 NA NA 1
18 0.1070810 NA NA NA 0.974597 -0.662043 0.000000 NA NA 1
19 0.0162706 NA NA NA 1.000000 -0.680642 0.000000 NA NA 1
AN DP4 MQ
11 1 3,0,3,2 25
12 1 0,0,10,6 60
14 1 0,0,12,5 60
16 1 0,0,4,6 60
18 1 0,0,4,5 60
19 1 0,0,8,4 60
Indiv gt_PL
11 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 131,0
12 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 255,0
14 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 255,0
16 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 241,0
18 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 230,0
19 /home/dcuser/dc_workshop/results/bam/SRR2584863.aligned.sorted.bam 255,0
gt_GT gt_GT_alleles
11 1 C
12 1 C
14 1 T
16 1 C
18 1 G
19 1 C
Exercise: Subsetting challenge
Recreate the output of head(variants) using subsetting instead
The subsetting notation is very similar to what we learned for vectors. The key differences include:
- Typically provide two values separated by commas:
data.frame[row, column] - In cases where you are taking a continuous range of numbers use a colon between the numbers (start:stop, inclusive)
- For a non continuous set of numbers, pass a vector using
c() - Index using the name of a column(s) by passing them as vectors using
c()
There is a lot to work with, so we will subset our columns of interest into a new data frame.
Challenge
Create a new data frame called subset_variants that contains only the
columns sample_id, CHROM, POS, and ALT from variants.
Hint: use head() or str(variants) to find which column numbers these correspond to.
Now, let's use the str() (structure) function to confirm your subest_variants dataframe looks as you expect it to:
r
Output
'data.frame': 801 obs. of 4 variables:
$ sample_id: chr "SRR2584863" "SRR2584863" "SRR2584863" "SRR2584863" ...
$ CHROM : chr "CP000819.1" "CP000819.1" "CP000819.1" "CP000819.1" ...
$ POS : int 9972 263235 281923 433359 473901 648692 1331794 1733343 2103887 2333538 ...
$ ALT : chr "G" "T" "T" "CTTTTTTTT" ...
Extra for experts: using logicals to confirm you correctly subsetted.
We know that our new subset_variants dataframe should have the same number of rows as our original dataframe variants.
You can confirm this using the nrow() function like so and check you get the same number:
But you can take this one step further using the logical operator == to compare the two statements. The code below is asking R, are the outputs of the two functions the same? If yes, it returns TRUE.
Data manipulating¶
So far we have been exploring the structure of our data. Now let's use what we have learned to do some simple analysis, going back to our research question.
We are interested in single nucleotide polymorphisms (SNPs) — positions in the genome where a single base differs from the reference. The ALT column contains the alternate allele at each variant position, but not all of these are single bases; some are longer insertions or deletions (indels) like CTTTTTTTT.
We hypothesise that there will be SNP differences between our Cit+ mutants and Cit- wildtype E. coli. Let's test this hypothesis.
First, orientate yourself to the data in our subset_variants using head() and a new function table()
r
The table() function lets us count up how many times each unique element appears in a given vector. For example, we can count how many times each unique sample ID appears in our dataframe, by passing to table() the column subset_variants$sample_id (which evaluates as a vector):
r
Note: What do our sample_ids correspond to? Go back to the Introduction to the dataset to remind yourself.
Next, we want to filter our data to keep only rows where ALT is a single nucleotide — A, T, G, or C — which removes indels and leaves us with just SNPs.
We will use the logical operator %in%. You can read this as "for each element in the vector on the left, return only those that match something in the vector on the right".
Finally, we can count how many of each SNP type each sample has using table(). This time, in order to get counts of each SNP per sample, we need to pass table() two vectors as arguments, to create a contingency table. It uses the first argument as the rows, and the second as columns, then cross-references them to count how many times each unique combination co-occurs.
r
Our Cit+ sample very clearly has a lot more alternative SNPs to the other two samples. Does this support our initial hypothesis?
Solution
Yes, this supports what we know and/or suspect about this sample. Under glucose-limiting citrate supplemented media, some strains of E.coli became hypermutable - so it makes sense this sample has many more SNPs compared to the reference genome!
Sorting and ordering¶
You can sort a dataframe using the order() or the sort() function. The sort() function sorts a column in a dataframe from smallest to largest. Rather than returning the sorted values themselves, the order() returns a vector of index positions that correspond to the sorted order — smallest to largest by default. Let's compare how they work.
r
Why do these outputs look so different? The order() function is returning the index positions that correspond to the smallest values, rather than the smallest values themselves.
We can then use these index positions to subset our dataframe rows, in the same way we used logical vectors to subset earlier (recall how snp_positions[snp_positions > 100000000] worked by evaluating each position to TRUE or FALSE inside the []). Here, instead of a logical vector, we are passing a vector of index positions inside the [].
Discussion: Why can we not use sort() in the above subsetting example?
Solution
The sort() function returns our actual values. However, when we subset out of a dataframe using the [] brackets, the values within the [] are interpreted as index positions. Everything before the comma "," is treated as all the row numbers you want to keep when you subset the dataframe variants. Therefore, if we used sort() it would think the actual DP numbers (e.g., the first one is 2) is row number 2 instead and subset that. In fact, row 2 would be repeated several times in the subsetted new dataframe, because the first several results returned by sort(variants$DP) are all 2.
The order() function lists values in increasing order by default. How could we change sorted_by_DP to start with variants with the greatest filtered depth ("DP")? We can include the argument decreasing = TRUE.
r
Math¶
There are lots of arithmetic functions you may want to apply to your data frame, covering those would be a course in itself (there is some starting material here).
You can use functions like mean(), min(), max() on an
individual column. Let's look at the "DP" or filtered depth. This value shows
the number of filtered reads that support each of the reported variants.
Exercise: Try out the mean() and min() functions on any numerical column in the variants dataframe.
Examples to try:
mean(variants$QUAL)min(variants$MQ)
Bonus: You can rename columns by logical subsetting or index:¶
r
Saving your data frame to a file¶
We can save data to a file. We will save our subset_variants object
to a .csv (comma-separated values) file using the write.csv() function:
The write.csv() function has some additional arguments listed in the
help, but at a minimum you need to tell it what data frame to write to
file, and give a path to a file name in quotes (if you only provide a
file name, the file will be written in the current working directory).
Importing data from Excel¶
Excel is one of the most common formats, so we need to discuss how to
make these files play nicely with R. The simplest way to import data
from Excel is to save your Excel file in .csv format. You can then
import into R right away. Sometimes you may not be able to do this
(imagine you have data in 300 Excel files, are you going to open and
export all of them?).
One common R package (a set of code with features you can download and add to your R installation) is the readxl package which can open and import Excel files. Rather than addressing package installation this second (we'll discuss this soon!), we can take advantage of RStudio's import feature which integrates this package.
readxl-RStudio integration
This feature is only available on RStudio version 1.0.44 or later.
First, in the RStudio menu go to File, select Import Dataset, and choose From Excel... (notice there are several other options you can explore).
Next, under File/Url: click the Browse
button and navigate to the Ecoli_metadata.xlsx file located at
/home/dcuser/dc_sample_data/R. You should now see a preview of the
data to be imported:
Notice that you have the option to change the data type of each variable by clicking arrow (drop-down menu) next to each column title. Under Import Options you may also rename the data, choose a different sheet to import, and choose how you will handle headers and skipped rows. Under Code Preview you can see the code that will be used to import this file. We could have written this code and imported the Excel file without the RStudio import function, but now you can choose your preference.
In this exercise, we will leave the name of the data frame as Ecoli_metadata, and there are no other options we need to adjust. Click the Import button to import the data.
Finally, let's check the first few lines of the Ecoli_metadata data
frame:
r
Output
# A tibble: 6 × 7
sample generation clade strain cit run genome_size
<chr> <dbl> <chr> <chr> <chr> <chr> <dbl>
1 REL606 0 NA REL606 unknown NA 4.62
2 REL1166A 2000 unknown REL606 unknown SRR098028 4.63
3 ZDB409 5000 unknown REL606 unknown SRR098281 4.6
4 ZDB429 10000 UC REL606 unknown SRR098282 4.59
5 ZDB446 15000 UC REL606 unknown SRR098283 4.66
6 ZDB458 20000 (C1,C2) REL606 unknown SRR098284 4.63
The type of this object is tibble, a type of data frame we will talk
more about in the dplyr section. If you needed a true
R data frame you could coerce with as.data.frame().
Review exercises¶
Exercise: Putting it all together - data frames
Using the Ecoli_metadata data frame created above, answer the following questions
A) What are the dimensions (# rows, # columns) of the data frame?
B) What are categories are there in the cit column? hint: treat column as factor
C) How many of each of the cit categories are there?
D) What is the genome size for the 7th observation in this data set?
E) What is the median value of the variable genome_size?
F) Rename the column sample to sample_id.
G) Create a new column named genome_size_bp and set it equal to the genome_size multiplied by 1,000,000.
H) Save the edited Ecoli_metadata data frame as "exercise_solution.csv" in your current working directory.
Solution
A)
B)
C)
D)
E)
F)
r
G)
r
Ecoli_metadata$genome_size_bp <- Ecoli_metadata$genome_size * 1000000
# Check the first few rows
head(Ecoli_metadata)
Output
# A tibble: 6 × 8
sample_id generation clade strain cit run genome_size genome_size_bp
<chr> <dbl> <chr> <chr> <chr> <chr> <dbl> <dbl>
1 REL606 0 NA REL606 unknown NA 4.62 4620000
2 REL1166A 2000 unknown REL606 unknown SRR098028 4.63 4630000
3 ZDB409 5000 unknown REL606 unknown SRR098281 4.6 4600000
4 ZDB429 10000 UC REL606 unknown SRR098282 4.59 4590000
5 ZDB446 15000 UC REL606 unknown SRR098283 4.66 4660000
6 ZDB458 20000 (C1,C2) REL606 unknown SRR098284 4.63 4630000
H)
Exercise: Review the arguments of the read.csv() function
Before using the read.csv() function, use R's help feature to
answer the following questions.
Hint: Entering '?' before the function name and then running that line will bring up the help documentation. Also, when reading this particular help be careful to pay attention to the 'read.csv' expression under the 'Usage' heading. Other answers will be in the 'Arguments' heading.
A) What is the default parameter for 'header' in the read.csv()
function?
B) What argument would you have to change to read a file that was delimited by semicolons (;) rather than commas?
C) What argument would you have to change to read file in which numbers used commas for decimal separation (i.e., 1,00)?
D) What argument would you have to change to read in only the first 10,000 rows of a very large file?
Solution
A) The read.csv() function has the argument 'header' set to TRUE
by default. This means the function always assumes the first row
is header information, (i.e., column names)
B) The read.csv() function has the argument 'sep' set to ",".
This means the function assumes commas are used as delimiters,
as you would expect. Changing this parameter (e.g., sep=";")
would tell R to interpret semicolons as delimiters.
C) Although it is not listed in the read.csv() usage,
read.csv() is a "version" of the function read.table() and
accepts all its arguments. If you set dec="," you could change
the decimal operator. We'd probably assume the delimiter is some
other character.
D) You can set nrow to a numeric value (e.g., nrow=10000) to
choose how many rows of a file you read in. This may be useful
for very large files where not all the data is needed to test
some data cleaning steps you are applying.
Hopefully, this exercise gets you thinking about using the provided help documentation in R. There are many arguments that exist, but which we wont have time to cover.


