Skip to content

4. Redirection

Lesson Objectives

  • Employ the grep command to search for information within files.
  • Print the results of a command to a file.
  • Construct command pipelines with two or more stages.
  • Use for loops to run the same command for several input files.

questions

  • How can I search within files?
  • How can I combine existing commands to do new things?

Searching files

We discussed in a previous episode how to search within a file using less. We can also search within files without even opening them, using grep. grep is a command-line utility for searching plain-text files for lines matching a specific set of characters (sometimes called a string) or a particular pattern (which can be specified using something called regular expressions). We're not going to work with regular expressions in this lesson, and are instead going to specify the strings we are searching for. Let's give it a try!

Nucleotide abbreviations

The four nucleotides that appear in DNA are abbreviated A, C, T and G. Unknown nucleotides are represented with the letter N. An N appearing in a sequencing file represents a position where the sequencing machine was not able to confidently determine the nucleotide in that position. You can think of an N as being aNy nucleotide at that position in the DNA sequence.

We'll search for strings inside of our fastq files. Let's first make sure we are in the correct directory:

code

$ cd ~/shell_data/untrimmed_fastq

Suppose we want to see how many reads in our file have really bad segments containing 10 consecutive unknown nucleotides (Ns).

Determining quality

In this lesson, we're going to be manually searching for strings of Ns within our sequence results to illustrate some principles of file searching. It can be really useful to do this type of searching to get a feel for the quality of your sequencing results, however, in your research you will most likely use a bioinformatics tool that has a built-in program for filtering out low-quality reads. You can learn how to use one such tool, called FastQC, in this Data Carpentry lesson on Data Wrangling and Processing for Genomics or as part of our other workshops RNA-seq Data Analysis or Microbial genome assembly with short reads.

Let's search for the string NNNNNNNNNN in the SRR098026 file:

$ grep NNNNNNNNNN SRR098026.fastq

This command returns a lot of output to the terminal. Every single line in the SRR098026 file that contains at least 10 consecutive Ns is printed to the terminal, regardless of how long or short the file is. We may be interested not only in the actual sequence which contains this string, but in the name (or identifier) of that sequence. We discussed in a previous lesson that the identifier line immediately precedes the nucleotide sequence for each read in a FASTQ file. We may also want to inspect the quality scores associated with each of these reads. To get all of this information, we will return the line immediately before each match and the two lines immediately after each match.

We can use the -B argument for grep to return a specific number of lines before each match. The -A argument returns a specific number of lines after each matching line. Here we want the line before and the two lines after each matching line, so we add -B1 -A2 to our grep command:

code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq

One of the sets of lines returned by this command is:

@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Can we avoid typiing N 10 times as it is a bit tedious 😵‍💫

Sure can. Use

grep -E -B1 -A2 "N{10}" SRR098026.fastq

  • -E: This option tells grep to use Extended Regular Expressions (ERE). In ERE, certain characters like {}, (), ?, +, and | have special meanings without needing to be escaped. This is crucial for our pattern N{10} to work as intended.
  • "N{10}": This is the pattern we're searching for:
    • N represents the literal character 'N'.
    • {10} is a quantifier that means "exactly 10 times".
    • Together, N{10} matches exactly 10 consecutive 'N' characters.

Exercise

  1. Search for the sequence GNATNACCACTTCC in the SRR098026.fastq file. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match.

  2. Search for the sequence AAGTT in both FASTQ files. Have your search return all matching lines and the name (or identifier) for each sequence that contains a match

Solution
  1. grep -B1 GNATNACCACTTCC SRR098026.fastq

    @SRR098026.245 HWUSI-EAS1599_1:2:1:2:801 length=35
    GNATNACCACTTCCAGTGCTGANNNNNNNGGGATG
    
  2. grep -B1 AAGTT *.fastq

    SRR097977.fastq-@SRR097977.11 209DTAAXX_Lenski2_1_7:8:3:247:351 length=36
    SRR097977.fastq:GATTGCTTTAATGAAAAAGTCATATAAGTTGCCATG
    --
    SRR097977.fastq-@SRR097977.67 209DTAAXX_Lenski2_1_7:8:3:544:566 length=36
    SRR097977.fastq:TTGTCCACGCTTTTCTATGTAAAGTTTATTTGCTTT
    --
    SRR097977.fastq-@SRR097977.68 209DTAAXX_Lenski2_1_7:8:3:724:110 length=36
    SRR097977.fastq:TGAAGCCTGCTTTTTTATACTAAGTTTGCATTATAA
    --
    SRR097977.fastq-@SRR097977.80 209DTAAXX_Lenski2_1_7:8:3:258:281 length=36
    SRR097977.fastq:GTGGCGCTGCTGCATAAGTTGGGTTATCAGGTCGTT
    --
    SRR097977.fastq-@SRR097977.92 209DTAAXX_Lenski2_1_7:8:3:353:318 length=36
    SRR097977.fastq:GGCAAAATGGTCCTCCAGCCAGGCCAGAAGCAAGTT
    --
    SRR097977.fastq-@SRR097977.139 209DTAAXX_Lenski2_1_7:8:3:703:655 length=36
    SRR097977.fastq:TTTATTTGTAAAGTTTTGTTGAAATAAGGGTTGTAA
    --
    SRR097977.fastq-@SRR097977.238 209DTAAXX_Lenski2_1_7:8:3:592:919 length=36
    SRR097977.fastq:TTCTTACCATCCTGAAGTTTTTTCATCTTCCCTGAT
    --
    SRR098026.fastq-@SRR098026.158 HWUSI-EAS1599_1:2:1:1:1505 length=35
    SRR098026.fastq:GNNNNNNNNCAAAGTTGATCNNNNNNNNNTGTGCG
    

Redirecting output

grep allowed us to identify sequences in our FASTQ files that match a particular pattern. All of these sequences were printed to our terminal screen, but in order to work with these sequences and perform other operations on them, we will need to capture that output in some way.

We can do this with something called "redirection". The idea is that we are taking what would ordinarily be printed to the terminal screen and redirecting it to another location. In our case, we want to print this information to a file so that we can look at it later and use other commands to analyse this data.

The command for redirecting output to a file is >.

Let's try out this command and copy all the records (including all four lines of each record) in our FASTQ files that contain 'NNNNNNNNNN' to another file called bad_reads.txt.

Code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
  • You will notice the NNNN.. characters aren't highlighted in red anymore. Perhaps grep might have a flag to retain the colour for searched pattern ?

File extensions

You might be confused about why we're naming our output file with a .txt extension. After all, it will be holding FASTQ formatted data that we're extracting from our FASTQ files. Won't it also be a FASTQ file? The answer is, yes - it will be a FASTQ file and it would make sense to name it with a .fastq extension. However, using a .fastq extension will lead us to problems when we move to using wildcards later in this episode. We'll point out where this becomes important. For now, it's good that you're thinking about file extensions!

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should see a new file called bad_reads.txt.

We can check the number of lines in our new file using a command called wc. wc stands for word count. This command counts the number of words, lines, and characters in a file. The FASTQ file may change over time, so given the potential for updates, make sure your file matches your instructor's output.

Code

$ wc bad_reads.txt
537  1073 23217  bad_reads.txt

This will tell us the number of lines, words and characters in the file. If we want only the number of lines, we can use the -l flag for lines.

$ wc -l bad_reads.txt
537 bad_reads.txt

Exercise

How many sequences are there in SRR098026.fastq? Remember that every sequence is formed by four lines.

Solution
$ wc -l SRR098026.fastq
996

Now you can divide this number by four to get the number of sequences in your fastq file.

Exercise

How many sequences in SRR098026.fastq contain at least 3 consecutive Ns?

Solution
$ grep NNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
249

We might want to search multiple FASTQ files for sequences that match our search pattern. However, we need to be careful, because each time we use the > command to redirect output to a file, the new output will replace the output that was already present in the file. This is called "overwriting" and, just like you don't want to overwrite your video recording of your kid's first birthday party, you also want to avoid overwriting your data files.

code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

code

$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq > bad_reads.txt
$ wc -l bad_reads.txt
0 bad_reads.txt

Here, the output of our second call to wc shows that we no longer have any lines in our bad_reads.txt file. This is because the second file we searched (SRR097977.fastq) does not contain any lines that match our search sequence. So our file was overwritten and is now empty.

We can avoid overwriting our files by using the command >>. >> is known as the "append redirect" and will append new output to the end of a file, rather than overwriting it.

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt
$ grep -B1 -A2 NNNNNNNNNN SRR097977.fastq >> bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

The output of our second call to wc shows that we have not overwritten our original data.

What if we now appended the SRR098026.fastq file onto bad_reads.txt again?

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq >> bad_reads.txt
$ wc -l bad_reads.txt
1074 bad_reads.txt

The line count has now doubled, as we have added the bad reads from SRR098026.fastq to the bad_reads.txt twice.

We can also grep results from both fastq files at once with a single line of code by using a wildcard:

$ grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.txt
$ wc -l bad_reads.txt
537 bad_reads.txt

You don't need to use the append >> above for this to work.

File extensions - part 2

This is where we would have trouble if we were naming our output file with a .fastq extension. If we already had a file called bad_reads.fastq (from our previous grep practice) and then ran the command above using a .fastq extension instead of a .txt extension, grep would give us a warning.

Code

grep -B1 -A2 NNNNNNNNNN *.fastq > bad_reads.fastq
grep: input file ‘bad_reads.fastq' is also the output

grep is letting you know that the output file bad_reads.fastq is also included in your grep call because it matches the *.fastq pattern. Be careful with this as it can lead to some unintended results.

Since we might have multiple different criteria we want to search for, creating a new output file each time has the potential to clutter up our workspace. We also thus far haven't been interested in the actual contents of those files, only in the number of reads that we've found. We created the files to store the reads and then counted the lines in the file to see how many reads matched our criteria. There's a way to do this, however, that doesn't require us to create these intermediate files - the pipe command (|).

This is probably not a key on your keyboard you use very much, so let's all take a minute to find that key. In the UK and US keyboard layouts, and several others, the | character can be found using the key combination Shift+\. This may be different for other language-specific layouts.

What | does is take the output that is scrolling by on the terminal and uses that output as input to another command. When our output was scrolling by, we might have wished we could slow it down and look at it, like we can with less. Well it turns out that we can! We can redirect our output from our grep call through the less command.

code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | less

We can now see the output from our grep call within the less interface. We can use the up and down arrows to scroll through the output and use q to exit less.

If we don't want to create a file before counting lines of output from our grep search, we could directly pipe the output of the grep search to the command wc -l. This can be helpful for investigating your output if you are not sure you would like to save it to a file.

Code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | wc -l

Because we asked grep for all four lines of each FASTQ record, we need to divide the output by four to get the number of sequences that match our search pattern. Since 802 / 4 = 200.5 and we are expecting an integer number of records, there is something added or missing in bad_reads.txt. If we explore bad_reads.txt using less, we might be able to notice what is causing the uneven number of lines. Luckily, this issue happens by the end of the file so we can also spot it with tail.

code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq > bad_reads.txt
$ tail bad_reads.txt
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
--
--
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

The sixth line in the output display "--" which is the default action for grep to separate groups of lines matching the pattern, and indicate groups of lines which did not match the pattern so are not displayed. To fix this issue, we can redirect the output of grep to a second instance of grep as follows.

code

$ grep -B1 -A2 NNNNNNNNNN SRR098026.fastq | grep -v '^--' > bad_reads.txt
$ tail bad_reads.txt
+SRR098026.132 HWUSI-EAS1599_1:2:1:0:320 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
ANNNNNNNNNTTCAGCGACTNNNNNNNNNNGTNGN
+SRR098026.133 HWUSI-EAS1599_1:2:1:0:1978 length=35
#!!!!!!!!!##########!!!!!!!!!!##!#!
@SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SRR098026.177 HWUSI-EAS1599_1:2:1:1:2025 length=35
#!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
  • -v: This option tells grep to invert the match, meaning it will return lines that do not match the specified pattern.
  • '^--': This is a regular expression where: ^ asserts that the following characters (--) must be at the start of the line.

Custom grep control

Use man grep to read more about other options to customise the output of grep including extended options, anchoring characters, and much more.

Redirecting output is often not intuitive, and can take some time to get used to. Once you're comfortable with redirection, however, you'll be able to combine any number of commands to do all sorts of exciting things with your data!

None of the command line programs we've been learning do anything all that impressive on their own, but when you start chaining them together, you can do some really powerful things very efficiently.

File manipulation and more practices with pipes

To practice a bit more with the tools we've added to our tool kit so far and learn a few extra ones you can follow this extra lesson which uses the SRA metadata file.

Writing for loops

Loops are key to productivity improvements through automation as they allow us to execute commands repeatedly. Similar to wildcards and tab completion, using loops also reduces the amount of typing (and typing mistakes). Loops are helpful when performing operations on groups of sequencing files, such as unzipping or trimming multiple files. We will use loops for these purposes in subsequent analyses, but will cover the basics of them for now.

When the shell sees the keyword for, it knows to repeat a command (or group of commands) once for each item in a list. Each time the loop runs (called an iteration), an item in the list is assigned in sequence to the variable, and the commands inside the loop are executed, before moving on to the next item in the list. Inside the loop, we call for the variable's value by putting $ in front of it. The $ tells the shell interpreter to treat the variable as a variable name and substitute its value in its place, rather than treat it as text or an external command. In shell programming, this is usually called "expanding" the variable.

Basic Structure of a for loop

The basic structure of a bash for loop looks like this:

for variable in list
do
    commands
done

Let's break down each part:

  1. for: This keyword starts the loop.
  2. variable: This is a temporary variable that takes on each value in the list, one at a time.
  3. in: This keyword separates the variable from the list.
  4. list: This is the set of items you want to loop through.
  5. do: This keyword marks the beginning of the commands to be executed in each iteration.
  6. commands: These are the actions you want to perform for each item in the list.
  7. done: This keyword marks the end of the loop.

Here's a simple example to help you understand:

for fruit in apple banana orange
do
    echo "I like $fruit"
done
This loop will output:
I like apple
I like banana
I like orange

How does it work:

  1. The loop starts with "apple" as the value of fruit.
  2. It executes the echo command with this value.
  3. Then it moves to the next item, "banana", and repeats.
  4. Finally, it does the same with "orange".

After the last item, the loop ends.

Remember, you can put any commands inside the loop, and they will be executed for each item in your list. This makes for loops a powerful tool for automating repetitive tasks in bash scripting.

Let's write a for loop to show us the first two lines of the fastq files we downloaded earlier. You will notice the shell prompt changes from $ to > and back again as we were typing in our loop. The second prompt, >, is different to remind us that we haven't finished typing a complete command yet.

$ cd ../untrimmed_fastq/
$ for filename in *.fastq
> do
> head -n 2 ${filename}
> done

The for loop begins with the formula for <variable> in <group to iterate over>. In this case, the word filename is designated as the variable to be used over each iteration. In our case SRR097977.fastq and SRR098026.fastq will be substituted for filename because they fit the pattern of ending with .fastq in the directory we've specified. The next line of the for loop is do. The next line is the code that we want to execute. We are telling the loop to print the first two lines of each variable we iterate over. Finally, the word done ends the loop.

After executing the loop, you should see the first two lines of both fastq files printed to the terminal. Let's create a loop that will save this information to a file.

$ for filename in *.fastq
> do
> head -n 2 ${filename} >> seq_info.txt
> done

When writing a loop, you will not be able to return to previous lines once you have pressed Enter. Remember that we can cancel the current command using

  • Ctrl+C

If you notice a mistake that is going to prevent your loop for executing correctly.

Note that we are using >> to append the text to our seq_info.txt file. If we used >, the seq_info.txt file would be rewritten every time the loop iterates, so it would only have text from the last variable used. Instead, >> adds to the end of the file.

Using Basename in for loops

Basename is a function in UNIX that is helpful for removing a uniform part of a name from a list of files. In this case, we will use basename to remove the .fastq extension from the files that we've been working with.

code

$ basename SRR097977.fastq .fastq

We see that this returns just the SRR accession, and no longer has the .fastq file extension on it.

SRR097977

If we try the same thing but use .fasta as the file extension instead, nothing happens. This is because basename only works when it exactly matches a string in the file.

Cdoe

$ basename SRR097977.fastq .fasta
SRR097977.fastq

Basename is really powerful when used in a for loop. It allows to access just the file prefix, which you can use to name things. Let's try this.

Inside our for loop, we create a new name variable. We call the basename function inside the parenthesis, then give our variable name from the for loop, in this case ${filename}, and finally state that .fastq should be removed from the file name. It's important to note that we're not changing the actual files, we're creating a new variable called name. The line > echo $name will print to the terminal the variable name each time the for loop runs. Because we are iterating over two files, we expect to see two lines of output.

code

$ for filename in *.fastq
> do
> name=$(basename ${filename} .fastq)
> echo ${name}
> done

Why Parentheses () ?

  • Command Substitution: The $(...) syntax is used for command substitution. It allows you to execute a command and use its output as a value in your script. In this case, $(basename ${filename} .fastq) executes the basename command and captures its output, which is then assigned to the variable name.
  • Clarity: Using $(...) is preferred over backticks (...) for command substitution because it is more readable and can be nested more easily.

Why Curly Braces {} ?

  • Variable Expansion: The ${filename} syntax is used to clearly indicate that you are referencing the variable filename. This is particularly useful in cases where the variable name might be adjacent to other characters that could be interpreted as part of the variable name.
  • Disambiguation: For example, if you had a variable named filename_suffix, writing $filename_suffix could lead to ,especially if you are trying to concatenate or manipulate it with other strings. Using ${filename} makes it clear where the variable name ends.
  • Consistency: While not always required, using curly braces for variable expansion is a common practice that enhances readability and reduces the risk of errors.

🙋 : In name=$(basename ${filename} .fastq), Can I switch {} and () as in name=${basename $(filename) .fastq} ? 🚫

  • Order Matters: You must use () for command substitution first, and within that, you can use {} for variable expansion as needed.
  • Contextual Importance: Always use $(...) for command substitution and ${...} for variable expansion to ensure clarity and correctness in your scripts.

In summary, while the two types of brackets serve different purposes, their correct order and usage are crucial for the intended functionality of your shell scripts.

Exercise

Print the file prefix of all of the .txt files in our current directory.

Solution
$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> echo ${name}
> done

One way this is really useful is to move files. Let's rename all of our .txt files using mv so that they have the years on them, which will document when we created them.

$ for filename in *.txt
> do
> name=$(basename ${filename} .txt)
> mv ${filename}  ${name}_2019.txt
> done
  • mv ${filename} ${name}_2019.txt:This line renames the file.
    • ${filename} is the original file name.
    • ${name}_2019.txt is the new file name, which consists of the original name (without .txt), followed by "_2019.txt".

Exercise

Remove _2019 from all of the .txt files.

Solution
$ for filename in *_2019.txt
> do
> name=$(basename ${filename} _2019.txt)
> mv ${filename} ${name}.txt
> done

keypoints

  • grep is a powerful search tool with many options for customisation.
  • >, >>, and | are different ways of redirecting output.
  • command > file redirects a command's output to a file.
  • command >> file redirects a command's output to a file without overwriting the existing contents of the file.
  • command_1 | command_2 redirects the output of the first command as input to the second command.
  • for loops are used for iteration.
  • basename gets rid of repetitive parts of names.